MP6 plasmid - 2 ug

https://www.gentaur.be/web/image/product.template/5625/image_1920?unique=c5125d0

674,00 € 674.0 EUR 674,00 €

674,00 €

Not Available For Sale

    Deze combinatie bestaat niet.

    Terms and Conditions
    30-dagen geld terug garantie
    Verzending: 2 tot 3 weken

    Plasmid host: Escherichia coli

    Plasmid usage: protein expression

    Fragment type: ORF

    Fragment species:

    Prokaryotic resistance: Chl

    Filter tags:

    Fluorescent labeling:

    Promoter: BAD

    Copier: CloDF13

    Number of copies: Low

    Perceived state: DH5a

    Temperature: 37 degrees

     

    MP6 Sequence

    AAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCCAACCGGTA
    ACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCA
    CGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGG
    ATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGACGCGTACAACTCAAGTCTGA
    CATAAATGACCGCTATGAGCACTGCAATTACACGCCAGATCGTTCTCGCTACCGCAACCACCGGTATGAACCAGATTGGT
    GCGCACTATGAAGGCCACAAGATCATTGAGATTGGTGCCGTTGAAGTGGTGAACCGTCGCCTGACGGGCAATAACTTCCA
    TGTTTATCTCAAACCCGATCGGCTGGTGGATCCGGAAGCCTTTGGCGTACATGGTATTGCCGATGAATTTTTGCTCGATA
    AGCCCACGTTTGCCGAAGTAGCCGATGAGTTCATGGACTATATTCGCGGCGCGGAGTTGGTGATCCATAACGCAGCGTTC
    GATATCGGCTTTATGGACTACGAGTTTTCGTTGCTTAAGCGCGATATTCCGAAGACCAATACTTTCTGTAAGGTCACCGA
    TAGCCTTGCGGTGGCGAGGAAAATGTTTCCCGGTAAGCGCAACAGCCTCGATGCGTTATGTGCTCGCTACGAAATAGATA
    ACAGTAAACGAACGCTGCACGGGGCATTACTCGATGCCCAGATCCTTGCGGAAGTTTATCTGGCGATGACCGGTGGTCAA
    ACGTCGATGGCTTTTGCGATGGAAGGAGAGACACAACAGCAACAAGGTGAAGCAACAATTCAGCGCATTGTACGTCAGGC
    AAGTAAGTTACGCGTTGTTTTTGCGACAGATGAAGAGATTGCAGCTCATGAAGCCCGTCTCGATCTGGTGCAGAAGAAAG
    GCGGAAGTTGCCTCTGGCGAGCATAATTTAATATCAGTAAACCGGACATAACCCATGAAGAAAAATCGCGCTTTTTTGAA
    GTGGGCAGGGGGCAAGTATCCCCTGCTTGATGATATTAAACGGCATTTGCCCAAGGGCGAATGTCTGGTTGAGCCTTTTG
    TAGGTGCCGGGTCGGTGTTTCTCAACACCGACTTTTCTCGTTATATCCTTGCCGATATCAATAGCGACCTGATCAGTCTC
    TATAACATTGTGAAGATGCGTACTGATGAGTACGTACAGGCCGCACGCGAGCTGTTTGTTCCCGAAACAAATTGCGCCGA
    GGTTTACTATCAGTTCCGCGAAGAGTTCAACAAAAGCCAGGATCCGTTCCGTCGGGCGGTACTGTTTTTATATTTGAACC
    GCTACGGTTACAACGGCCTGTGTCGTTACAATCTGCGCGGTGAGTTTAACGTGCCGTTCGGCCGCTACAAAAAACCCTAT
    TTCCCGGAAGCAGAGTTGTATCACTTCGCTGAAAAAGCGCAGAATGCCTTTTTCTATTGTGAGTCTTACGCCGATAGCAT
    GGCGCGCGCAGATGATGCATCCGTCGTCTATTGCGATCCGCCTTATGCACCGCTGTCTGCGACCGCCAACTTTACGGCGT
    ATCACACAAACAGTTTTACGCTTGAACAACAAGCGCATCTGGCGGAGATCGCCGAAGGTCTGGTTGAGCGCCATATTCCA
    GTGCTGATCTCCAATCACGATACGATGTTAACGCGTGAGTGGTATCAGCGCGCAAAATTGCATGTCGTCAAAGTTCGACG
    CAGTATAAGCAGCAACGGCGGCACACGTAAAAAGGTGGACGAACTGCTGGCTTTGTACAAACCAGGAGTCGTTTCACCCG
    CGAAAAAATAATTCAGCTAAGACACTGCACTGGATTAAGATGAAAACGATTGAAGTTGATGATGAACTCTACAGCTATAT
    TGCCAGCCACACTAAGCATATCGGCGAGAGCGCATCCGACATTTTACGGCGTATGTTGAAATTTTCCGCCGCATCACAGC
    CTGCTGCTCCGGTGACGAAAGAGGTTCGCGTTGCGTCACCTGCTATCGTCGAAGCGAAGCCGGTCAAAACGATTAAAGAC
    AAGGTTCGCGCAATGCGTGAACTTCTGCTTTCGGATGAATACGCAGAGCAAAAGCGAGCGGTCAATCGCTTTATGCTGCT
    GTTGTCTACACTATATTCTCTTGACGCCCAGGCGTTTGCCGAAGCAACGGAATCGTTGCACGGTCGTACACGCGTTTACT
    TTGCGGCAGATGAACAAACGCTGCTGAAAAATGGTAATCAGACCAAGCCGAAACATGTGCCAGGCACGCCGTATTGGGTG
    ATCACCAACACCAACACCGGCCGTAAATGCAGCATGATCGAACACATCATGCAGTCGATGCAATTCCCGGCGGAATTGAT
    TGAGAAGGTTTGCGGAACTATCTAACGGCTGAAATTAATGAGGTCATACCCAAATGGATAGTTCGTTTACGCCCATTGAA
    CAAATGCTAAAATTTCGCGCCAGCCGCCACGAAGATTTTCCTTATCAGGAGATCCTTCTGACTCGTCTTTGCATGCACAT
    GCAAAGCAAGCTGCTGGAGAACCGCAATAAAATGCTGAAGGCTCAGGGAATTAACGAGACGTTGTTTATGGCGTTGATTA
    CGCTGGAGTCTCAGGAAAACCACAGTATTCAGCCTTCTGAATTAAGTTGTGCTCTTGGATCATCCCGTACCAACGCGACG
    CGTATTGCCGATGAACTGGAAAAACGCGGTTGGATCGAACGTCGTGAAAGCGATAACGATCGCCGCTGCCTGCATCTGCA
    ATTAACGGAAAAAGGTCACGAGTTTTTGCGCGAGGTTTTACCACCGCAGCATAACTGCCTGCATCAACTCTGGTCCGCGC
    TCAGCACAACAGAAAAAGATCAGCTCGAGCAAATCACCCGCAAATTGCTCTCCCGTCTCGACCAGATGGAACAAGACGGT
    GTGGTTCTCGAAGCGATGAGCTAATAATACAAAAATTAGGAGGAATTTCAACATGACAAATTTATCTGACATCATTGAAA
    AAGAAACAGGAAAACAACTAGTGATTCAAGAATCAATTCTAATGTTACCAGAAGAAGTAGAGGAAGTAATTGGGAATAAA
    CCAGAAAGTGATATTTTAGTTCATACTGCTTATGATGAAAGTACAGATGAAAATGTAATGCTATTAACTTCAGATGCTCC
    AGAATATAAACCTTGGGCTTTAGTAATTCAAGACAGTAATGGAGAAAATAAAATTAAAATGTTATAAGTCGAGATTAAGT
    AAACCGGAATCTGAAGATGACCGACGCGGAATACGTTCGTATCCACGAAAAACTGGACATCTACACCTTCAAAAAACAGT
    TCTTCAACAACAAAAAATCTGTTTCTCACCGTTGCTACGTTCTGTTCGAACTGAAACGTCGTGGTGAACGTCGTGCGTGC
    TTCTGGGGTTACGCGGTTAACAAACCGCAGTCTGGTACCGAACGTGGTATCCACGCGGAAATCTTCTCTATCCGTAAAGT
    TGAAGAATACCTGCGTGACAACCCGGGTCAGTTCACCATCAACTGGTACTCTTCTTGGTCTCCGTGCGCGGACTGCGCGG
    AAAAAATCCTGGAATGGTACAACCAGGAACTGCGTGGTAACGGTCACACCCTGAAAATCTGGGCGTGCAAACTGTACTAC
    GAAAAAAACGCGCGTAACCAGATCGGTCTGTGGAACCTGCGTGACAACGGTGTTGGTCTGAACGTTATGGTTTCTGAACA
    CTACCAGTGCTGCCGTAAAATCTTCATCCAGTCTTCTCACAACCAGCTGAACGAAAACCGTTGGCTGGAAAAAACCCTGA
    AACGTGCGGAAAAACGTCGTTCTGAACTGTCTATCATGATCCAGGTTAAAATCCTGCACACCACCAAATCTCCGGCGGTT
    TAAACTTAATTAACGGCACTCCTCAGCCAAGTCAAAAGCCTCCGGTCGGAGGCTTTTGACTACATGCCCATGGCGTTTAC
    GCCCCGCCCTGCCACTCATCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAAACGGCATG
    ATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATAGTGAAAACGGGGGCGAAGA
    AGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCA
    ATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA
    ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTAT
    CCCATATCACCAGCTCACCGTCTTTCATTGCCATACGGAACTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATA
    AAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATA
    GGTACATTGAGTAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAG
    TGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT
    TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCAAGCCAAATAGGCCGTCACTCGGTCGCTACGCTCCGGGCGTGAGAC
    TGCGGCGGGCGCTGCGGACACATACAAAGTTACCCACAGATTCCGTGGATAAGCAGGGGACTAACATGTGAGGCAAAACA
    GCAGGGCCGCGCCGGTGGCGTTTTTCCATAGGCTCCGCCCTCCTGCCAGAGTTCACATAAACAGACGCTTTTCCGGTGCA
    TCTGTGGGAGCCGTGAGGCTCAACCATGAATCTGACAGTACGGGCGAAACCCGACAGGACTTAAAGATCCCCACCGTTTC
    CGGCGGGTCGCTCCCTCTTGCGCTCTCCTGTTCCGACCCTGCCGTTTACCGGATACCTGTTCCGCCTTTCTCCCTTACGG
    GAAGTGTGGCGCTTTCTCATAGCTCACACACTGGTATCTCGGCTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTAAGC
    AAGAACTCCCCGTTCAGCCCGACTGCTGCGCCTTATCCGGTAACTGTTCACTTGAGTCCAACCCGGAAAAGCACGGTAAA
    ACGCCACTGGCAGCAGCCATTGGTAACTGGGAGTTCGCAGAGGATTTGTTTAGCTAAACACGCGGTTGCTCTTGAAGTGT
    GCGCCAAAGTCCGGCTACACTGGAAGGACAGATTTGGTTGCTGTGCTCTGCGAAAGCCAGTTACCACGGTTAAGCAGTTC
    CCCAACTGACTTAACCTTCGATCAAACCACCTCCCCAGGTGGTTTTTTCGTTTACAGGGCAAAAGATTACGCGCAGAAAA
    AAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACTGAACCGCTCTAGATTTCAGTGCAATTTATCTCTTCAAATGTAGC
    ACCTGAAGTCAGCCCAGGAGGAAGAGGACATCCGGTCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTT
    TAGACTTAGGGACCCTTTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAACTCGCTCGGG
    CTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGAT
    AGGCATCCGGGTGGTGCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAATCCCTA
    ACTGCTGGCGGAAAAGATGTGACAGACGCGACGGCGACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTG
    TCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCGGTGGATGGAGCGACTCGTTAATCGC
    TTCCATGCGCCGCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCCGGCGT
    TAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATT
    GACGGCCAGTTAAGCCATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGG
    ATGACGACCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGGTCGGCAAACAAATTCTCGTCCCTGAT
    TTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCCCAGCGGTCGGTCGATAAAAAAATCG
    AGATAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCAGGGGATCATT
    TTGCGCTTCAGCCATACTTTTCATACTCCCACCATTCAGAG
    //

     

    Notes:
    1. This product is FOR RESEARCH USE ONLY!
    2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.Take 2ul plasmid into 100 μ L corresponding competent cell, centrifugal then full coating on plate.
    3. Shipping temperature is 2-8℃.