Overslaan naar inhoud

pEYFP-N1, 2ug

https://www.gentaur.com.pl/web/image/product.template/1480/image_1920?unique=325b45d
(0 beoordeling)

0,00 € 0.0 EUR 0,00 € Exclusief btw

info@gentaur.com

    Deze combinatie bestaat niet.

    Algemene voorwaarden
    30-dagen geld terug garantie
    Verzending: 2 tot 3 weken

    pEYFP-N1 Information

    Promoter: CMV

    Replicon: pUC ori, F1 ori

    Terminator: SV40 poly (A) signal

    Plasmid classification: mammalian cells, fluorescent protein reporter vectors

    Plasmid size: 4733bp

    Prokaryotic resistance: Kan

    Selection marker: Neo

    Clonal strain: DH5 alpha

    Culture conditions: 37

    Expression host: lactation cells

    Induction mode: no need to induce, transient expression.

    5'sequencing primers: pEGFP-C-5:CATGGTCCTGCTGGAGTTCGTG

    Primers for 3'sequencing: primers designed based on sequences

     

    pEYFP-N1 Description

    encodes an enhanced yellow-green variant of the Aequorea victoria green fluorescent protein (GFP). The EYFP gene contains four amino acid substitutions previously published as GFP-10C (1). The fluorescence excitation maximum of EYFP is 513 nm, and the emission spectrum has a peak at 527 nm (in the yellow-green region). When excited at 513 nm, the Em of EYFP is 36,500 cm–1M–1 and the fluorescence quantum yield is 0.63 (1), resulting in a bright fluorescent signal. The fluorescence level observed from EYFP is roughly equivalent to that from EGFP.

     

    pEYFP-N1 Multiple cloning site

    pEYFP-N1 Sequence

    LOCUS       Exported File           4733 bp ds-DNA    circular SYN 25-1-2015

    DEFINITION  .

    ACCESSION   .

    VERSION     .

    KEYWORDS    Untitled

    SOURCE      synthetic DNA construct

      ORGANISM  synthetic DNA construct

    REFERENCE   1  (bases 1 to 4733)

      AUTHORS   .

      TITLE     Direct Submission

      JOURNAL   Exported 2015-1-25 from SnapGene 2.0.1