PXMJ19, 2 ug

(0 beoordeling)

481,00 € 481.0 EUR 481,00 € Exclusief btw

481,00 € Exclusief btw

Not Available For Sale

    Deze combinatie bestaat niet.

    Terms and Conditions
    30-dagen geld terug garantie
    Verzending: 2 tot 3 weken


    Catalog No. PVT11360
    Packing 2ug


    pXMJ19 Information

    Vector name: pXMJ19

    Plasmid type: Corynebacterium glutamiens / Escherichia coli shuttle plasmid

    Resistance Chl

    Growth Strain  DH5α

    Culture medium  LB

    Temperature  37℃

    High copy / low copy: -

    Promoter: -

    Cloning methods: polyclonal sites, restrictive endonucleases

    Carrier size: 6601bp

    5'sequencing primers and sequences: LacI-R: GGCATACTCTGCGACATCGT;


    3'sequencing primers and sequences: --

    Carrier label: -

    Carrier resistance: chloramphenicol

    Screening markers: -

    Note: -

    Genbank: AJ133195.1


    pXMJ19 Sequence



    Product is for research use only!