PEX18TC plasmid - 2 µg

https://www.gentaur.be/web/image/product.template/1673/image_1920?unique=f907e5c
(0 beoordeling)

0,00 € 0.0 EUR 0,00 € Exclusief BTW

540,00 € Exclusief BTW

info@gentaur.com

    Deze combinatie bestaat niet.

    Terms and Conditions
    30-dagen geld terug garantie
    Verzending: 2 tot 3 weken

    pEX18TC

    PVT10636            Packing 2ug

     

    pEX18TC Information

    Carrier name: pEX18Tc, pEX-18Tc

    Plasmid type: Suicide Plasmid

    Cloning method: restriction endonuclease, polyclonal site

    Promoter: Lac

    Carrier size: 6349 BP

    5'sequencing primers and sequences: M13F (-47) CGCCAGGGTTTTCCCAGTCACGAC

    3'sequencing primers and sequences: M13R (-48) AGCGGATAACAATTTCACACAGGA

    Carrier resistance: tetracycline

    Virus / non virus: non viral

    Function E.coli Editing plasmids

     

    pEX18TC Reference
    1. Biswas I., Mettlach J. (2019) Targeted Gene Replacement in Acinetobacter baumannii. In: Biswas I., Rather P. (eds) Acinetobacter baumannii. Methods in Molecular Biology, vol 1946. Humana Press, New York, NY

    DOI   https://doi.org/10.1007/978-1-4939-9118-1_10
    Publisher Name    Humana Press, New York, NY

     

    Cloning vector pEX18Tc, complete sequence


    Caution:
    1.  This product is FOR RESEARCH USE ONLY!
    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.