Hypothetical protein BG908_05820 201bp in pUC vector - 100ug plasmid + 200ul glycerol

(0 beoordeling)

370,00 € 370.0 EUR 370,00 € Exclusief btw

370,00 € Exclusief btw

Not Available For Sale

    Deze combinatie bestaat niet.

    Terms and Conditions
    30-dagen geld terug garantie
    Verzending: 2 tot 3 weken

    DNA sequence: 

    RC46GOI: atgagaaattctacttataaacaaaacaaaatttttattttagcctatgttatatttggattgttcatgggtctattttttgacttattgttatcaactcacatatacacattaagtcttttaagtatattttttggcttttttatactaggagtaatctttaagattatcctttcatgccaaaataaaaaacatatttag

    Protein sequence: