Skip to Content
  1. All products
  2. Monkeypox virus dsDNA control (79 bp) - 200 nmol (HPLC Purified)
  3. All products
Pricelist: Price List Default - EUR Pricelist
Pricelist: Price List Default - EUR Pricelist
Monkeypox virus dsDNA control (79 bp) - 200 nmol (HPLC Purified)

Monkeypox virus dsDNA control (79 bp) - 200 nmol (HPLC Purified)

(0 review)
0.00 € 0.00 € (Tax excluded)

Add to cart
Buy now
Terms and Conditions
30-day money-back guarantee
Shipping: 2-3 Business Days
Contact Us
Sense (5'-3') Sequence:
CACACCGTCTCTTCCACAGATAAATGCGAACCCGTCGTAACCAGCAATACATTTAACTATATCGATGTGGAAATTAACC